Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14717E9
Clone ID IST14717E9
Vector VICTR76
Project tigm

Sequence tag IST14717E9BBF1
Sequence
TTTTGTAAACAAACTGTAGCCAAACGGCCCCCACAGAACCTACCATGGATCT
Sequence Type genomic DNA
Unitrap ID UNI16740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71098680..71098729 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]


Sequence tag IST14717E9HMR1
Sequence
CATTGGAACTCTACACAGATCATCTTTAAATGCATGGCTCAGTGCTCTAGTTTAGACGATTCTGAAATAATTGTTGGCTA
CAGCTTGCATTACAGAATAAACTGAGGTGCTATAGCACCTGCCTAGCATCTGGGGGAGCCTCACCCCCAGCATTGTCAAA
ACAATCTTTTCAAAACTGATGTGTGGGTACACAGTTATGTTANTGAGCTGCATGGGTGACTGATCAAACATTCNACATGC
TTATGACCCCAAANCANNCCTGCTCCCACTTCCTGGTGTGTGTTANATTCNTGTTTTTAANATGAACCATAAAAATGANN
GGCANNNNNNNNANTCTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14717E9HMF1
Sequence
TTTTGTAAACAAACTGTAGCCAAACGGCCCCCACAGAACCTACCATGGATCCACCCTCCTGTCAGGAGAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI16740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71098680..71098757 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es