Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G068F06
Clone ID G068F06
Vector U3CEO
Project ggtc

Sequence tag G068F06
Sequence
GNNNNCAGATCATTCCGTNNNACTTCCCGCTCCTGATGCAAGCATGGAAACTGGGCCCAGCCCTGGCAACCGGGAACGTG
GTGGTGATGAAGGTGGCCGAGCAGACACCGCTCACCGCGCTCTACGTGGCCAACTTGATCAAGGAGGCAGGCTTTCCCCC
TGGCGTGGTCAATATCGTTCCCGGATTCGGCCCTACCGCCGGGGCTGCCATAGCATCCCATGAGGGTGGGACAAAGTGGC
GTTCA
Sequence Type mRNA
Unitrap ID UNI11307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122025114..122026029 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029455 (Aldh2) NM_009656 aldehyde dehydrogenase 2, mitochondrial Gene [Source:MGI (curated);Acc:Aldh2-001]

 
Come back to gene ENSMUSG00000029455


For any suggestions or comments, please send an email to unitrap@crg.es