Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G067B12
Clone ID G067B12
Vector U3CEO
Project ggtc

Sequence tag G067B12
Sequence
TNNNGAAACATCCTAGCTCGGCGTTGGAGTTGAGTCGCCTGAGGTCCCCGCCGACGACGCACTCACCATGGCGCCTGCTA
ACCTTGGGCTGACGCCGCACTGGGTGATGCTCCTCGGTGCCGTGCTGCTGTTGCTTCTGTCAGAAGCCCCCCCTCTAGGT
TCGTGCAAAGATAGGTTCNNATGTGAGTTCGCAGCCAGNNTCCTTTGAAGTAGTGCCANNANNCNNGTCAAAG
Sequence Type mRNA
Unitrap ID UNI11219

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 77044504..77044650 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009291 (Pttg1ip) NM_145925 pituitary tumor-transforming 1 interacting protein Gene [Source:MGI Symbol;Acc:MGI:2652132]

 
Come back to gene ENSMUSG00000009291


For any suggestions or comments, please send an email to unitrap@crg.es