Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12229B5
Clone ID IST12229B5
Vector VICTR76
Project tigm

Sequence tag IST12229B5HMF1
Sequence
CCTCTGCCTGTACAGTCCACTGACCCAGCCTGAGCGCTGAGACTCTCCCATGTTCCTCAGCCTCAGGACAGCATTTGGCC
GCCTTCCCATCTTAGGACAGTTTCCAGACCTTCAGGAGCTTGATCTAGCTGCCCTCAATTCCAAGCTCAGCGGGTGCCCC
GTGCAGAAGCCAGGTATTTTTCTTTTAGTTTTACTCTTTTAGGCTGTCATGGGTCTGCCACGTGACCTTGAGTGAACTTT
CCGGTACATGGGGTGGGGGGTGGGGGAAGGCNCTAAGTCNCCANATTCCCTGTCNNCTCNGGACCNCCCCTTTCCTTAGC
NAATNNGCTCTGANAACAACCTGTN
Sequence Type genomic DNA
Unitrap ID UNI13104

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3235662..3236005 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034614 (Pik3ip1) NM_178149 phosphoinositide-3-kinase interacting protein 1 Gene [Source:MGI (curated);Acc:Pik3ip1-001]

 
Come back to gene ENSMUSG00000034614


For any suggestions or comments, please send an email to unitrap@crg.es