Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11376H5
Clone ID IST11376H5
Vector VICTR76
Project tigm

Sequence tag IST11376H5BBF1
Sequence
GGTGGTGCTGAGCTGCGAGCATCCTNGCTGCNTCCTTCTGGGGAAAAGGAAAGGATCGTTTGGAGCCGGCAGTTTCCAGC
TTCCTGGGGGCCATTTGGAATTCGGGTGAGCAGGACGACCTCCGGGAAGCGGAAGCTTCGGGAATATCACTAGTCCGCAC
GCCATTCTCGGTCCGTGTGACGCGCTTCANTGCGCAGTTGAGTTCCGCGAGCTCTCTACGGCCCCGGTGTCCTCCGGGAT
CT
Sequence Type genomic DNA
Unitrap ID UNI31840

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 73924731..73924971 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033405 (Nudt15) NM_172527 nudix (nucleoside diphosphate linked moiety X)-type motif 15 Gene [Source:MGI Symbol;Acc:MGI:2443366]


Sequence tag IST11376H5HMF2
Sequence
CAACAACAAAATTTACACCTGTAACAAAGATGTTTAGCTNCNAAGTCNCCATCACCGTTGTTATTTCTCCNCCAGTGAAA
TGAGCCAATTCAAGCCANATTAGNATATNTTAAAGGAAGGTTTATTGGGAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000033405


For any suggestions or comments, please send an email to unitrap@crg.es