Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12324C3
Clone ID IST12324C3
Vector VICTR76
Project tigm

Sequence tag IST12324C3HMF1
Sequence
TTGTGAAGTCCTGTGGAAGCTGCCTGGAATTGGAGGGAAGGTGGGACATCAAGTGCACATGGGCATAGCTAATAACATTG
GCCTCGTGTTTCTCATTGGTGTTGCCTAACTCAGATACTGTTGGCATTGTTCTTAAACAAGTGTTACATCTTCTTGAAAA
ACATCTTCCCTGTTTGCTAACTACTCCTGTGTGGGAATAAGGAAAATAACAGGAGTGGAAC
Sequence Type genomic DNA
Unitrap ID UNI11458

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130297877..130298096 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026356 (Dars) NM_145507 aspartyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2442544]

 
Come back to gene ENSMUSG00000026356


For any suggestions or comments, please send an email to unitrap@crg.es