Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0863
Clone ID CC0863
Vector pGT0lxfT2
Project sanger

Sequence tag CC0863
Sequence
TAGGCAATACTTGGAGGGTAGCAATATATATCGTCTGAACTTGTGTCTTAGGTTAGGGGGACAGACTTTTTGTAAAGATC
GGTGCAATAGAGCTGGGTTTTTGATGATGAAGAAGAAAGCAAATTAACCTACACAGAAATCCATCAAGAATACAAAGAGC
TGGTTGAAAAGCTGTTAGAAAGTTACCTCAAAGAGATTGGAATTAATGAAGATCAGTTTCAAGAAGCGTGCACGTCCCCT
CTGGCGAAGACGCGCACATCACAG
Sequence Type mRNA
Unitrap ID UNI1496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 29144059..29146394 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020462 (Ccdc104) NM_025740 coiled-coil domain containing 104 Gene [Source:MGI (curated);Acc:Ccdc104-001]

 
Come back to gene ENSMUSG00000020462


For any suggestions or comments, please send an email to unitrap@crg.es