Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14139E6
Clone ID IST14139E6
Vector VICTR74
Project tigm

Sequence tag IST14139E6HMF1
Sequence
AAGGCAGGTCTTCCCTTCAGCTAATCCTATCTGTATGTATCTTCAAACACAGCCACAAATGGACCACAACAGCCCCTGGG
TGGTTCTAGATCTAGGCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104153450..104153551 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST14139E6HMR1
Sequence
CCTTGAATGTGGGTGGTACCATCCCATGGGCTGGGGGTTAAGGCAGTACGGAACGCANAGGAAGGAAGGANAAATCACAC
CCAAAGCTACACTCCTTTGGGCTCTCTATCTACCAAGAAGAGCTTCCTCCACCACAGGCAATGCTCTGTCCAAGGAGGAC
ACAGGAGCCCATGAGCCAAAACAAANCTTTCCTCACTGAGTCATCTCTGTCAGGTGTCTGGGCACTCAGGAGATGTTCCA
TGGGAAAAGGTGGCCTCTAAGCTCCTGCAGAGATGCCNCTGTCCCCTCCTACCCACCTGCCCCGCACTANCTCANANCAN
CGGCTGGTTTNNAACAAGGCTGTGGGCCTGACTGTCACATCTGACTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104153084..104153453 350
NO GENE  


Sequence tag IST14139E6BBF1
Sequence
NANGNNGGTCTTCCCTTNANCTAATCCTATCTGTATGTATCTTCAAACACAGCCNCNNATGGANCACAACAGCCCCTGGG
TGGTTCTANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es