Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15051F6
Clone ID IST15051F6
Vector VICTR80
Project tigm

Sequence tag IST15051F6HMR1
Sequence
NAGCTGTGGGTGGGTGGTTTATGGGCTGGTGTGGGGCTGAGGGGCATGGGAACAGGAAGTGGATGGAGGCTGGACATGCA
GAGAGCCAGGTTGCTGGCTGCACCTCCTAGCTGTCCTGCACAGTCTGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI14326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28479999..28480129 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002249 (Tead3) NP_035696 TEA domain family member 3 Gene [Source:MGI Symbol;Acc:MGI:109241]


Sequence tag IST15051F6HMF2
Sequence
CTCTGTCCTGGCCCACATGGCAGATGGATCAATGCTCCGGAAAGAGGGGTGGGCACCCTTTCTCTCCCTTGTACCTCAGC
AACCCCAGAACACTGGAACCTGAAATCAGAGTTCTTGGGGCCTCCAGACCTTAATAAGCTTTGCTCTGGGGCAGTAAGAA
TGCCATGTCTGCCAGCCTGGTGGCTCACACCTCTAATCCAGCACTCAGGAGGCAGAGGCAGGCAGCTCTCCGAATTTGAG
GCCNGCCTGGTGTACAGAGCAAGTTCCAAGACAGCCATATCTATGTTAGAGACGGTCTCTCGCTGTAGCCCAAGCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28480128..28480445 316
NO GENE  

 
Come back to gene ENSMUSG00000002249


For any suggestions or comments, please send an email to unitrap@crg.es