Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G066A07
Clone ID G066A07
Vector U3CEO
Project ggtc

Sequence tag G066A07
Sequence
TTCTATGTGCCAGAGATGAAACCATCCATGTTTGATGTGAGCAGGGAGCTGGGCTCCAGCGTGGCACTGTATAGCCGCAA
GGTCCTCATCCAGACCAAGGCTGCAGACATCCTGCCCAAGTGGCTGCGCTTCATTCGAGGTGTGGTGGATAGTGAGGACA
TTCCCCTGAACCTCAGCAGAGAGCTCCTGCAGGAGAGTGCGCTCATCCGGAAACTCCGGGATGTTCTACAACAGAGATTG
ATCAAGTTCTTCATTGACCAGAGTAAAAAAGATGGTCAAAAATACGCAAAGTGTCTTGAAAATTATGGCTTGTTCATGAG
GGAGGGCACTGTGACCACTGCAGAGCATGACATCAAG
Sequence Type mRNA
Unitrap ID UNI11319

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4049351..4054771 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005981 (Trap1) NM_026508 TNF receptor-associated protein 1 Gene [Source:MGI (curated);Acc:Trap1-001]

 
Come back to gene ENSMUSG00000005981


For any suggestions or comments, please send an email to unitrap@crg.es