Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14648E5
Clone ID IST14648E5
Vector VICTR74
Project tigm

Sequence tag IST14648E5HMR1
Sequence
NCNGTGAGTGCCTGGCACCCGTGCCTTGCTCTCCTTGGGCCTCTAACAAAGAGGCCTGCACTCAGCCAAGCCTCTCTCGG
CCCAGGACAACCCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI31232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95481357..95481450 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]


Sequence tag IST14648E5HMF2
Sequence
GTGTTCTTTTTCTATTTTATTTTGGTAAAGTATGTATGACATAAATTGGTTTTGGGGGGGGGCTGGGAANAAAATTCAGT
GGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91543596..91543679 82
NO GENE  


Sequence tag IST14648E5BBF1
Sequence
GTGTTCTTTTTCTATTTTATTTTGGTAAAGTATGTATGACATAAATTGGTTTTGGGGGGGGGCTGGGAANAAAATTCANT
GGTTAACAGCACTTATATACAAACAGGAGGACCTAAGTTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91543596..91543720 121
NO GENE  

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es