Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13396A5
Clone ID IST13396A5
Vector VICTR74
Project tigm

Sequence tag IST13396A5HMF1
Sequence
CAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCGACCGCTGCTGCTGTGGCT
TAGGCCGCCTCCCCTGCCGGGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCAGCC
Sequence Type genomic DNA
Unitrap ID UNI4014 UNI31227

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12577687..12577822 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 60113410..60113545 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 82116077..82116212 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 70947039..70947174 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 22619813..22619948 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 84628976..84629111 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 14462460..14462595 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54200869..54201004 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020332 (4930404A10Rik) NP_083381 RIKEN cDNA 4930404A10 gene Gene [Source:MGI Symbol;Acc:MGI:1922097]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 82369454..82369589 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35521377..35521512 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 57052681..57052816 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 59583137..59583272 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 7437295..7437430 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 21861245..21861380 134
 
EST/CDNA Est Name
  BX512183.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 56650610..56650745 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55880216..55880351 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 66036148..66036283 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 37020305..37020440 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 46152259..46152394 134
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7324704..7324839 134
NO GENE  


Sequence tag IST13396A5BBF1
Sequence
NTTTATCAATGTCAAGAGTATATTCTGTAAATGCCACCAAACCTTTGAATGGTGCTAANAATGTGCCTCTCANANCACAA
CAAAACTAAAACTGGAAAATGAAAATCTCANCTAAATAGTCAAATATTTATTTANCACCTAGGAAATCAGGTAAAGCTAA
AACTCTGCANTCTACTTGTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128794155..128794335 167
NO GENE  

 
Come back to gene BX512183.1


For any suggestions or comments, please send an email to unitrap@crg.es