Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14414H4
Clone ID IST14414H4
Vector VICTR74
Project tigm

Sequence tag IST14414H4HMR1
Sequence
GAGATGTTCCCTTGTCTCCGTTTGTCTGTGCCCTTCATGGAGATTAGCAGCTGGCTAACATA
Sequence Type genomic DNA
Unitrap ID UNI15043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36057827..36057888 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]


Sequence tag IST14414H4HMF1
Sequence
TCTCCTGTGATGGACGTACCTCCACCTTCTAAGTGCTGGGGAATGTTNNANNCTTCTTACTAANNANCCNAAATTCCTAT
CCAACTTCAAAGTGAATTTGAGTTGAGGGTTACTTGGTTTAAAATGGTGGGAAACCATCAATCCTGGCTAGTCNCTAAAC
ATCTACCACAACTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14414H4BBF1
Sequence
ATCTCCTGTGATGGACGTACCTCCACCTTCTAAGTGCTGGGGAATGTTCTACACTTCTTACTAAAGATCCTAAATTCCTA
TCCAACTTCAAAGTGAATTTGAGTTGAGGGTTACTTGGTTTAAAATGGTGGGAAACCATCAATCCTGGCTAGTCACTAAA
CATCTACCACAACTGCATCCTGAAGCTGTTCAGAAAACAAGGTCCATGCAAGCCAGGCTACTTTTTAAAAAAGTCTTCTA
ACAAGAGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36057584..36057831 248
 
EST/CDNA Est Name
  BY444918.1 - BP753521.1 - BG065600.2

 
Come back to gene BY444918.1 - BP753521.1 - BG065600.2


For any suggestions or comments, please send an email to unitrap@crg.es