Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10873E6
Clone ID IST10873E6
Vector VICTR76
Project tigm

Sequence tag IST10873E6HMR1
Sequence
CTGGGATTTGAACTCAGGACCTTTGAAAGAGCAGTCAGTGCTCTTACCTGCTGAGCCATCTCACCAGCCCAACAAATTCT
TTTAAATAAAGAAATAGTAAAAAAGTTACATTGCAACTTGATTTGTGAATTTACATATTTTTGTGTGAAGTCTCCCAGCA
AGATAAAAATGTGTCTTCTTTCTCAGCATGAAACCTAGTAGCTCTAGAAAAATGAGGCTTGATTTTACACATGAAATGGT
TC
Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100445217..100445457 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]


Sequence tag IST10873E6BBF1
Sequence
CCCAGCAACCACATGGTGGCTCACAACCACCCGTAACGAGATCTGT

Sequence Type genomic DNA
Unitrap ID UNI35682 UNI35683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 51494204..51494248 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073565 (Prr16) NM_001081224 proline rich 16 Gene [Source:MGI Symbol;Acc:MGI:1918623]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 55992397..55992441 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050077 (Zbtb11) zinc finger and BTB domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:2443876]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 59168050..59168094 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9052812..9052856 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 75175029..75175073 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5022537..5022581 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106148049..106148093 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 38545217..38545261 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113893305..113893349 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 89767191..89767235 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66404397..66404441 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 14032387..14032431 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87863632..87863676 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 45263227..45263271 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119441855..119441899 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 88229372..88229416 45
NO GENE  

 
Come back to gene ENSMUSG00000050077


For any suggestions or comments, please send an email to unitrap@crg.es