Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14561H10
Clone ID IST14561H10
Vector VICTR74
Project tigm

Sequence tag IST14561H10HMR1
Sequence
ATCTATCTTTCNTTCTTTCNNTNNTTCNTTCNTTCTTTCTTTCTTCCTTCTTTCCTTCCTTCCTTCCTTTTTTTCTTTTT
TTGATACCTGAGATTCAGCCCAGGGCTGCTTACATGTGCTGGGAGAGTACTCTTCCACTGAGCTAATCTGTAGTCCTGTT
TGAGTGTGGGTTTGTTTTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84864696..84864882 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14561H10BBF1
Sequence
AGATTATGTTAACCCAGTGTCTAGGAGTGGATATTAGAGCAGCTTATATTTCCAGTACTCTAGAGGCTAAGGTAGGCTCA
TCATAAGTCCCAGGACTGCCTAGGCAAATCCCTGCCTCAAAGAAACAAAAATGCAGAATAAATTACTGATTTTCAATGAG
TGCTGCACAATTTTGGGTTCAAGGATACAAGCAGCATAAAAGATTAAAACTAGCCCGGTGTGGTGGCACACGCCTTTGAT
CCCAGCACTCGGGAGGCAGAGGCAGGCGAATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCC
AGGGATATACAGAGAAACCTTGTCTCGAAAAAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84864338..84864699 362
NO GENE  

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es