Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14038B7
Clone ID IST14038B7
Vector VICTR74
Project tigm

Sequence tag IST14038B7BBF1
Sequence
TGTGTGTCTGCCAATGTTCTGACCAGATATGTGCCCATTGCTGAACCTTCATTANACTCTTTCCTTGTACCCCTCCCCTA
CCCATTTCTTGAAAATAGACATTGTTTANATCTG
Sequence Type genomic DNA
Unitrap ID UNI31864 UNI31865

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 22454420..22454532 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76362646..76362758 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 70648129..70648241 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 46250506..46250618 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 66900337..66900449 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034544 (Rsrc1) NM_025822 arginine/serine-rich coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1914130]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 15163644..15163756 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24736853..24736965 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038072 (Galnt11) NM_144908 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 Gene [Source:MGI (curated);Acc:Galnt11-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 73237078..73237190 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 71271784..71271896 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125688952..125689064 109
NO GENE  


Sequence tag IST14038B7HMF2
Sequence
CCATCTTCCCTTCTCCTGNCTGGCTCCTTCCTGTCACTGTGGACTCCGCCTGGGGCTTGTCCTAANATTTCCTTCTCACT
CTCCAATTTCCTTATTTGGCCCTCTGCCCTGCANTTTCTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10209292..10209416 119
NO GENE  

 
Come back to gene ENSMUSG00000038072


For any suggestions or comments, please send an email to unitrap@crg.es