Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12818H1
Clone ID IST12818H1
Vector VICTR76
Project tigm

Sequence tag IST12818H1HMR1
Sequence
AATTTTGCTTTAAAATAATTTTATGTGCATAGTGTTTTGCTCTCGTATATATGTGTACTACATGTGTATTCTGCATGTGT
GACTGGTGTCCAGGGAGGCCAGAAGAGGATGCCAGATCCCTTGGCAGTGAAGTTAGGGATGGTGGCCANCT
Sequence Type genomic DNA
Unitrap ID UNI31488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41537917..41538064 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038332 (Sesn1) NM_001013370 sestrin 1 Gene [Source:MGI (curated);Acc:Sesn1-001]


Sequence tag IST12818H1HMF2
Sequence
AATTCATTTACTTATTAGATTTGATTATTTTACTAAGGTAAAANNNANATAAAATACAAAACTAANNNNNNTAATCTTTG
CAAGGTATTCTCATATTTCTTGGTAATCTATCAGATTTTAAAAATATATAGTCATGAAAAAAGTACAATATAGAATGGAC
AACTTCTTATGCTGTTAAGTTTCATATGATTTTTCCTTTTTATAAACTTGAATTTTTCTCAATATATTTACTTGAAAAGT
ATAGCACAAAATAAGTGGTACAGATACATTTAACAATAAAATGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41537633..41537920 268
NO GENE  

 
Come back to gene ENSMUSG00000038332


For any suggestions or comments, please send an email to unitrap@crg.es