Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13387F7
Clone ID IST13387F7
Vector VICTR74
Project tigm

Sequence tag IST13387F7BBF1
Sequence
GATTCAGCCCCCACTCTCGGTACATAGACACTTACAAAGCATTATCTGGGAGGCTATGCTGCTTGTANTAAATGAAGAGT
GGGATCT
Sequence Type genomic DNA
Unitrap ID UNI31867

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63968361..63968446 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032401 (Lctl) NM_145835 lactase-like Gene [Source:MGI (curated);Acc:Lctl-001]

 
Come back to gene ENSMUSG00000032401


For any suggestions or comments, please send an email to unitrap@crg.es