Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14623A11
Clone ID IST14623A11
Vector VICTR74
Project tigm

Sequence tag IST14623A11HMR1
Sequence
TCTCTGTGCTGAAGTGTAATTAGTCACAGTTCANAAGGAAGCCATGCCTGGTGGGATTGAGACTGCCCAGAGACCCTAGG
GTCCTGATGCCTGTGATAAAGGCTGCTAGAATC
Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165701817..165701929 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST14623A11HMF1
Sequence
GAATGAGGAAGGATTATTTAAAGGACGCAGGCTGAGTGGAAAGCTGGGCTAAGAAAGGANAAAGGCAGGCCCCCCTTAGC
TAGGAAGGTCTGTCACCCAGAACCTTCTCTGCCTCCCCGTTGGAACACAGGTTCAACAGAGCAGGCCCTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165701933..165702084 150
 
EST/CDNA Est Name
  CJ169184.1


Sequence tag IST14623A11BBF1
Sequence
GAATGAGGAAGGATTATTTAAAGGACGCAGGCTGAGTGGAAAGCTGGGCTAAGAAAGGAGAAAGGCAGGCCCCCCTTAGC
TAGGAAGGTCTGTCACCCAGAACCTTCTCTGCCTCCCCGTTGGAACACAGGTTCAACAGAGCAGGCCCTGTCAACCTAAC
ACTTCACAAGCCAAGCAGAAGGAAAAGCAGATAGAGCTGCTGTTATAGGCAAGTGCTAGAATGTCTCAGGCATTCCAAGA
TGCTGCTTTAGGGAGATGCTAAGCAACCGCTCTAGGTGCCATCCCANCANANCAGGGTTCAGCAAGAAGAAAATAGGCGC
ATCACCAATGGACATGGCTGGAATTTTCCATTGNGAANGCAANANAGGAAAACAGCTGAGAANGCTGTGCTGTCTGCGTC
NCGTGCTCTGTGTCAGANNGGCAGCCTCCANCCTGNAAGCTTGGGGTAAGATGNANTCCTGTTTGGGNNANCTCCNNNTN
TN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165701933..165702407 439
 
EST/CDNA Est Name
  AK003657.1

 
Come back to gene AK003657.1


For any suggestions or comments, please send an email to unitrap@crg.es