Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11059D7
Clone ID IST11059D7
Vector VICTR76
Project tigm

Sequence tag IST11059D7HMF1
Sequence
CCATCTCCTGCTCAGACACTTGCAGAGTCAAGCCCCAGTGATGTAGGACATCTTTGTGCCTGAGCCCCTGGTCAGGCCAG
GTGGACCTCCACTCCCCTGGCCCTCATGCACCTTTCTTGGCAATGANAGTTTTGAAGGAAACAGCCCAAGCCCCTTCCAC
CCCTACCATGCATCCAAAGAAGATTCCATTCAAGTTGGGTGCCCACAGGCACTGGGAGTCATTTCACTGTTTGTGGGGAG
CCNAGGTATAGATTTCTGTGCCCCGCCTTCAGGGACGTTGAGCTGGCTCCCTGACCACCCCCTCCATATTGGATGGA
Sequence Type genomic DNA
Unitrap ID UNI31869

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125159106..125159421 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006362 (Cbfa2t3) NM_009824 core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human) Gene [Source:MGI Symbol;Acc:MGI:1338013]


Sequence tag IST11059D7BBF1
Sequence
CCATCTCCTGCTCAGACACTTGCAGAGTCAAGCCCCAGTGATGTAGGACATCTTTGTGCCTGAGCCCCTGGTCAGGCCAG
GTGGACCTCCACTCCCCTGGCCCTCATGCACCTTTCTTGGCAATGAGAGTTTTGAAGGAAACAGCCCAAGCCCCTTCCAC
CCCTACCATGCATCCAAAGAAGATTCCATTCAAGTTGGGTGCCCACAGGCACTGGGAGTCATTTCACTGTTTGTGGGGAG
CCAAGGTATAGATTTCTGTGCCCCGCCTTCANGGACGTTGAGCTGGCTCCCTGACCACCCCCTCCATATTGGATGGCCAC
ATCTGGCCNCAGCCCCGGTTCCNACGTCCTGAAGGCCCTGCCACCCGCCCGCAGCTTCTGAACTGCATCATGGACATGGT
GGANAAGANCCGGCGATCCCTCACCGTCCTGCGCCGGTGTCAGGANGCCGACCGTGAGGAACTCAACCNCTGGNTCT

Sequence Type genomic DNA
Unitrap ID UNI31869

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125158946..125159421 460
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006362 (Cbfa2t3) NM_009824 core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human) Gene [Source:MGI Symbol;Acc:MGI:1338013]

 
Come back to gene ENSMUSG00000006362


For any suggestions or comments, please send an email to unitrap@crg.es