Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14523G1
Clone ID IST14523G1
Vector VICTR74
Project tigm

Sequence tag IST14523G1HMR1
Sequence
NGGCAGAGTTACATTGGNNNNNTTACCTCCCGGTGGTGGGTCGGTGNNCNGGGCCCNNACNGNANGTCANTACTGANGCT
TANACGCCTGATTGAAATTTCAGATCACTGTTGANAGTCTGAGCAGAANAAACAAACTGAAGATGAGAAATAGAGTATAA
AGTAAAGGTATTCAAATTAAAGCAATTAAAGTTTAGCTGGATTCCCTTTAAATCCAAAACCGAAGGAAAACAAGAAGAAC
CCGGACATGTACCTGTAACCCTGCAGTGTGGTAAAAAGACATGCTNNTATAGAGGCAAATGCTTTTAACATGGTCCTGGG
AACTATGACGTTGATGGCACCGGGTGTGANGACNANCGTAATTGTATTACTAAGGGTCAGAGGTGTATGCNGCTATCTGG
GAAGGAANGCAGGATTTTGATTTCTGAANGTGTTGCCTGTGTTTGTGGTTTCCNGTTACTTTATTTATTTANGNNNGTGC
NGGN
Sequence Type genomic DNA
Unitrap ID UNI12335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127385413..127385895 383
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031984 (2810004N23Rik) NM_025615 RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]


Sequence tag IST14523G1BBF1
Sequence
CAGTACCAAGGGCCTCTCCATCCACTGATGCCAGACAATGCCATCCTCTGCAGCTGGAGCCATGGGTCCCCTTCATGTGA
ATTCTTTGGTTGGTGATTTAGTCCCTGGGAGCTCTGAGGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 66832286..66832412 127
NO GENE  

 
Come back to gene ENSMUSG00000031984


For any suggestions or comments, please send an email to unitrap@crg.es