Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14951D6
Clone ID IST14951D6
Vector VICTR76
Project tigm

Sequence tag IST14951D6HMR1
Sequence
TTCNTTTCCTCATCTGTAAACAGTTAGCTGTAGTGTCACTCTCCGCACAAAAGAGAGAGAGATCTTCCAAAGCGAATATC
AGGTGATGGAGAAGATGGCAGGCCTGGCTTGACCTGTGGGTTTTAATGGG
Sequence Type genomic DNA
Unitrap ID UNI12953

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38450850..38450975 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002844 (Adprh) NM_007414 ADP-ribosylarginine hydrolase Gene [Source:MGI Symbol;Acc:MGI:1098234]


Sequence tag IST14951D6BBF1
Sequence
GAAGCTAAGTTTACATAATCAATAGGTACAGACCATGGAATCCGACCTAGTTCCCTGCCGCCAGAATGCTTCATATTACA
TGGTCTGGGCCCTGGCCTTAACTTTGGGCTCAGGTAAAGTGATAATGGAAAAACCCAGATGTGTAATGAGGGATGAATGA
ATGAATGAATGAATTTCCATAAAGTACATAGTGAGCACAACTTTGTGATTATTTTTATTATCCATCTACAACCAATTCTA
TAAGCAATTTTCCCTTTACCAGCAATATTTAAAAATTTTTAAATGATTTAGTTTTATTTACATATTCTAGTTTATATTCA
GTTTTATTTACNTACTCTAGTTTTTTGGCTTCACTGGTATCNGTGTGAGGGTGTTGGGCCCNCTGGAACTGGCTNTGTGA
NCTGCCANGTGNGTGCNNGNANNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38450978..38451393 402
 
EST/CDNA Est Name
  CJ287480.1 - AA036436.1 - W10726.1 - CX231997.1 - BG296322.1 - BE284298.1 - BF100831.1 - CB202928.1 - CX229528.1 - BG808424.1 - BU919965.1 - BI986094.1 - BQ891378.1 - BE307696.1 - CF902320.1 - BI081038.1 - CX208998.1 - CF160699.1 - BU562291.1 - CX225098.1


Sequence tag IST14951D6HMF1
Sequence
NAAGCTAANTTTACATAATCAATAGGTACAGACCATGGAATCCGACCTAGTTCCCTGCCGCCAGAATGCTTCATATTACA
TGGTCTGGGCCCTGGCCTTAACTTTGGGCTCANGTNNCNTGATAATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene CJ287480.1 - AA036436.1 - W10726.1 - CX231997.1 - BG296322.1 - BE284298.1 - BF100831.1 - CB202928.1 - CX229528.1 - BG808424.1 - BU919965.1 - BI986094.1 - BQ891378.1 - BE307696.1 - CF902320.1 - BI081038.1 - CX208998.1 - CF160699.1 - BU562291.1 - CX225098.1


For any suggestions or comments, please send an email to unitrap@crg.es