Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14933E7
Clone ID IST14933E7
Vector VICTR76
Project tigm

Sequence tag IST14933E7HMF1
Sequence
ACAATCAGTCCTTTTAAAAAATATTTTTCTCTGCTTTGATACTTTTTGGAATTTGCTTTCAGGTTGGTCTGAATTGTCTA
ATTCTCCTTCTAGCCTCAGCCTCACATGCACTAAGAATATAGTCATCAGCCACCATGCCTGGCTCTCTTCTGCTCTTTTT
TTTTTTTNAAAA
Sequence Type genomic DNA
Unitrap ID UNI31425

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120806511..120806681 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054484 (Tmem62) NM_175285 transmembrane protein 62 Gene [Source:MGI (curated);Acc:Tmem62-001]


Sequence tag IST14933E7HMR1
Sequence
ACAGTANAGCCGAGTANCAAGACACCGAGGAACTTGCTTCNTGGAATCNTCNTTNGTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000054484


For any suggestions or comments, please send an email to unitrap@crg.es