Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14239E7
Clone ID IST14239E7
Vector VICTR74
Project tigm

Sequence tag IST14239E7BBF1
Sequence
GACCTCGAGGGGAAAGAGTTCCCAGTTTTTATAGGCCCTCAGGGGGGAAAGGAGAAGGGGGAGATTAGGGGATTTCCAGA
TCTG
Sequence Type genomic DNA
Unitrap ID UNI11872 UNI31881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 43915590..43915672 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 86234673..86234755 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 52766363..52766445 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7756223..7756305 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 63135872..63135954 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62334292..62334374 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 20179934..20180016 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4578768..4578850 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 63341972..63342054 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 106360986..106361068 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 22188313..22188395 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44869324..44869406 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035649 (Zcchc7) NM_177027 zinc finger, CCHC domain containing 7 Gene [Source:MGI (curated);Acc:Zcchc7-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 129746860..129746942 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001052 (Sec24b) NM_207209 Sec24 related gene family, member B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2139764]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17662109..17662191 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26822424..26822506 83
NO GENE  


Sequence tag IST14239E7HMF2
Sequence
NACCTCGAGGGGAAAGANTTCCCAGTTTTTATAGGCCCTCAGGGGGGAAAGGAGAAGGGGGAGATTANGGGATTTCCNGA
TCTAAACAATGTCTATTCTCAAGANATGGGTATGGGAGGGGTACAAGGAAAGAGTCTAATGAAGGTGCANCNNTGGGCAC
NCACCTGTTCANAACATTGGCNNANNCNCANGTTCNAGGANTGNCCNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14239E7HMR1
Sequence
NGTCCCAGCTTANCNCCNNNNNNTGGGTCGGTGNNANGCANGGGGATGACTGTGTGTGATTTTCTGAGGCAGAGGGATGA
CAGTGAGTGATTTTCTGACACAGGGGGATGACTGTGAGTGATTTTCTGAGGCAGGGGGATGACTGTGAGTGATTTTCTGA
GGCAGAGGGATGACAGTGAGTGATTTTCTGAGGCAGGGGGCTGACTGTNAGTGATTTTCTGAAGCAGGGGGCTCACTGTG
AGTGATTTTCTGAGGCAATGGGGATCACTGTGANTGAATGTATNAGGCANGNGCTGACTGTNNNTGANTTTCNGAGGCNN
GGNGATNACNGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000001052


For any suggestions or comments, please send an email to unitrap@crg.es