Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11346A1
Clone ID IST11346A1
Vector VICTR76
Project tigm

Sequence tag IST11346A1HMR1
Sequence
CATTTGTGTACATACATGCACATAGAGGTTCANAGGGCAATCTTGAATGTCCTTCCTCAGGAGCTATCTAACTTTTAAAA
ATTCTTATTGATATTGTTATTGAGGTGCTCTGGTGCACATATGAAGATCAGAGGACAACAATGAGAAATGGAGAAATGGC
CCTTATGGAGGCTCTGGGAGTAANATAAAGATGCTAGGCTTGGGTGGCAAGCATCCTAACCTGTGCATCATCTCCCTTGT
GTTTGANACAGCGTCTGTTGGACCTGGGCTCTGTGTTCANGTTANTCNNTTTGG
Sequence Type genomic DNA
Unitrap ID UNI10410

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121334571..121334864 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027242 (Wdr76) NM_030234 WD repeat domain 76 Gene [Source:MGI (curated);Acc:Wdr76-002]


Sequence tag IST11346A1HMF1
Sequence
TTGAACTCCCACCACCACCACCACCACCGAGGTGTGCACTCACCCCGAGTGCACACCAACAAGAAACATTCAGCCGTTAC
TTCTGCCCACTTTCTTGCAATACAACTATGAGAAAATTACGCCTCACCACTGCTATACAGTTTTCAATCATAATAAAGGG
AACAGCTAANCACGGTGAATCCCGCCTGCCTGTCNCCCNAGACTTGGGAGGTGGAGGCAGGTGGGCTANAAATTCANTCT
TCATCATCNNCTATATAGGTAAATCAAGGGAAACCTGTANTACATGAACTCCANTCNCNNANNNAAAGGGAGCACTGAAN
GAAAANAAGGANGGCGCTGGANAGATGGCTCANTGGTTAAGAGCACTGACTGCTCTTCAAAAGGTCCTGANTTCANGTCC
CANCAACTACNTGGTGGNTCACAACCNTCTGTAATGGGATCCGATGCCCTCTTCTGGTATGTGTGACAGCTACNNTGTAT
TTGTATAAATNACATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11346A1BBF1
Sequence
TTGAACTCCCACCACCACCACCACCACCGAGGTGTGCACTCACCCCGAGTGCACACCAACAAGAAACATTCAGCCGTTAC
TTCTGCCCACTTTCTTGCAATACAACTATGAGAAAATTACGCCTCACCACTGCTATACAGTTTTCAATCATAATAAAGGG
AACAGCTNACCACGGTGAATCCCGCCTGCCTGTNNCCCNAGACTTGGGAGGTGGANGCAGGTGGGCTANAAATTCNNTCT
TCATCATCANCTATATAGGTAAATCAAGGGAAACCTGTANTACATGAACTCCANTCNCNNNNNNANANGGANCACTGAAA
GAAAANAAGGNNGGCGCTGGANAGATGGCTCANTGGTTAANAGCACTGACTGCTCTTCAAAAGGTCCTGAGTTCANNTCC
CANCNACTACATGGTGGCTCACAACCNTCTGTAATGNNATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027242


For any suggestions or comments, please send an email to unitrap@crg.es