Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14552G2
Clone ID IST14552G2
Vector VICTR74
Project tigm

Sequence tag IST14552G2HMR1
Sequence
TTTNNANTGCTGGGATTTAAAAAACACGCTACCATGCCTGCTTTCTAGTACTTTCTTTGTTTTAACTGG
Sequence Type genomic DNA
Unitrap ID UNI2398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22019776..22019837 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]


Sequence tag IST14552G2HMF1
Sequence
GAAAGAAGGCACAGAATGACCAGGAGCCAGCGATTTTCTAGGCTAGCCAGGTTATAGCCCTGTCTCAAAACACAAACACT
TCTTTGCTCTGAGCTGTGTCTCAACATGCTGCTGCCTAAGTACTATACAGAGCTTCAATTGGTGTAGTTTCCACAAATTC
CCATAAGAACAAAAACCATTCTTCCATAGTATAGCCAACATCACAGAAATTGCAAAAGATTCAGAGGTTCTGACGGTTTA
AAATTATCTCCTTTGTAATATCATGGGTTACAATCACTCTGTGACAACTGTAGGTGACTGCTTAATGTAATATCTTATCT
GCCTGCCCTTTATAGACTGTAAAAGAAAAAAGTAAAGGGCCTACCTATTATTTATAGTTTCGTTTTTTGCTTTTTTTACA
TTTTTACTACTGTGTATGTTCGCCTATTATTTACAGTTTACGGACAGGCAGGCAGGCAGGCGGGTAGATAGAGTGGACAT
GTATGANTGTGTATGTGATGACNTGGTGCATGCATGGAATCGGAGCATGANANTCNNTTCTCTCTTTCCNNCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22019218..22019771 538
 
EST/CDNA Est Name
  BQ557824.1 - BM202440.2


Sequence tag IST14552G2BBF1
Sequence
GAAAGAAGGCACAGAATGACCAGGAGCCAGCGATTTTCTAGGCTAGCCAGGTTATAGCCCTGTCTCAAAACACAAACACT
TCTTTGCTCTGAGCTGTGTCTCAACATGCTGCTGCCTAAGTACTATACAGAGCTTCNNNNGNTGTAGTTTCCACAAATTC
CCATAAGAACAAAAACCATTCTTCCATAGTATAGCCAACATCACAGAAATTGCAAAAGATTCAGAGGTTCTGACGGTTTA
AAATTATCTCCTTTGTAATATCATGGGTTACAATCACTCTGTGACAACTGTAGGTGACTGCTTAATGTAATATCTTATCT
GCCTGCCCTTTATAGACTGTAAAAGAAAAAAGTAAAGGGCCTACCTATTATTTATAGTTTCGTTTTTTGCTTTTTTTACA
TTTTTACTACTGTGTATGTTCGCCTATTATTTACAGTTTACGGACAGGCAGGCAGGCAGGCGGGTAGATAGAGTGGACAT
GTATGANTGTGTATGTGATNACATGGTGCATGCNTGGAATCGGANCATGANANTCANTTCTCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22019228..22019771 520
 
EST/CDNA Est Name
  BQ557824.1 - BM202440.2

 
Come back to gene BQ557824.1 - BM202440.2


For any suggestions or comments, please send an email to unitrap@crg.es