Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14279F4
Clone ID IST14279F4
Vector VICTR74
Project tigm

Sequence tag IST14279F4HMR1
Sequence
GTGGTCCAGGTCTACAGTGCCAGTCTGTCCTGGGCGGGCTGGATCTGGTGCAAGCATAGTTTGTTTTGCCCAAATGAGAG
CATGTTTATTGTCCTTTATCAGCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI30181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104133407..104133513 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST14279F4HMF1
Sequence
NCACTTANAGTGGACACAGCANAAATCNANGTCANGGANAGGCANGANAAAGGAGGCCCGGGCACACATTTANGTTCTGA
GCTTCAANAACACTCTGCTGAANCCGCGGCCTTGCTGGTTGCCAAGTGTCCACTGAGCAGCANAAAGACCCAAAGAAGGC
CTGCATGGGAATTATGTCCAGAAACAGGGAGGCTGGTGGGAGTGGGGGAAGGGGGATTCANGNNNANATGGGGGGAANAA
GGGAATGANAAAGAANCCCAAAGAACTTANGAAATGAAATTCTACTCGGAAAATTAAAAAGGACAAAACATCGTGGAAGA
NAGGGAGGGAGAGCACATTANTGCATGCNCATGCNTGCACACNTATGTGTTTGTGTATGTGCNNNCACATGTGTANNTGT
GCNTATGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es