Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14217F2
Clone ID IST14217F2
Vector VICTR74
Project tigm

Sequence tag IST14217F2HMR1
Sequence
NACAAGAAAGNNNNTCTNAGCATTTGTTTGCTCGAACCGAGGGTGTTGCTCCATGATAGTGTAAGACCCTACATTTAATT
TCTAGGACCACAACAAAAAGTTAAGCCATGGTTCTTTTTCATTAAAGTACTAGAGTATATAAGTTACTCGTAATGTAGTT
TATTACAATTTTCTGTTAAAGACTCTCCTTTATTTTTTGAAGGAAGAATGANATAACAACTGTGTTTCATTATAACTCTA
TGAGAACCAAAGTGGTTAGCTCACACTTGTAATTCCAACATTCAGGAAGTGGAGGAAGAAN
Sequence Type genomic DNA
Unitrap ID UNI8019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57681004..57681302 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004661 (Arid3b) NM_019689 AT rich interactive domain 3B (BRIGHT-like) Gene [Source:MGI Symbol;Acc:MGI:1930768]


Sequence tag IST14217F2BBF1
Sequence
TTTGGGGGCTCGTCCGGGANCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000004661


For any suggestions or comments, please send an email to unitrap@crg.es