Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A054C07
Clone ID A054C07
Vector pT1betageo
Project ggtc

Sequence tag A054C07
Sequence
CGCCAGCATCAATGGGAAGAGGAAGAGACTGGAATGTTGACTTAATTCCCAAGTTCCTTATGGCCAATGGTCAGTTGGTG
AAGATGCTGCTTTTCACAGAGGTCACTCGTTACATGGACTTCAAAGTGATTGAGGGAAGCTTTGTCTACAAGGGAGGGAA
AATCTACAAGGTTCCTTCCACTGAAGCAGAAGCCCTGGCATCTA
Sequence Type mRNA
Unitrap ID UNI11340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3550266..3553792 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021218 (Gdi2) NM_008112 guanosine diphosphate (GDP) dissociation inhibitor 2 Gene [Source:MGI Symbol;Acc:MGI:99845]

 
Come back to gene ENSMUSG00000021218


For any suggestions or comments, please send an email to unitrap@crg.es