Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10895E12
Clone ID IST10895E12
Vector VICTR76
Project tigm

Sequence tag IST10895E12HMR1
Sequence
NNCTCTCTACCCTATCCATTCCAAAACCACCCCAAGCCACCAGTCTCTGACAGCTTAACCCTTCCTCCTCCCTTGGGCGC
CTTTGGAAGCCGACCATCTGGCTTGGAGCCTATTTGCATATTGTCTGGGCCTCANCAAGCCAAGCAANNNNNAGGGGGGG
GGC
Sequence Type genomic DNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29694878..29695037 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]


Sequence tag IST10895E12BBF1
Sequence
CTGCCTGCCTGCCTTCTCACTCCTGAGCATGGTCTCCCTCCTGGGGCTGCCATTTACAAGACAAGCATTTATTGAGCAAC
TATCCTAGGCCAGGCACTAGGGCCAGCAAGATGGATGCANAGCTGTCCTCATCAAAGAGGCANCANACATGACTTANTTA
GCGGTGCTGGGAGCTACCTCCTTTGGGACCAGAAAAGGCCTTTCCAAGAGCACTAACAGTGAANCTTAGGCCTGAAGAAT
GAATGGGCTTGGGTGGTGATAGCTTTNTGGACAGAANAAGGGACATATGTAAAGAGCCAANGTACTGTGCAACTGGCNNG
NTCAANGCANCANGATGGANGANGCANGAAGANCANCATTANNGACCCTGGGAAGAANGCCCTCTCTGGATGANGCTGCC
CCCTNCTNNTGAACCCTAGAAGTTCTGGTGAGCTGTGTACTCCCTGGTNCCATGTCTCNATGTTTCTNNGNCCCANGCTC
NANGATGCTGNCC

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es