Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14757B6
Clone ID IST14757B6
Vector VICTR76
Project tigm

Sequence tag IST14757B6HMR1
Sequence
AGGGGCAATGTGTTTCCTGGTATCTGTGATTTAAGTTTCTTGTTTTGCCCTATTTGAGCGTTGTTTAAAGTAATTAGTTT
GTTGATAAGAGGAAGAGGAAAAATTGTGCAGGTCAAACAGGATTGGAAATTTAACGTGTTTAGCGTATGGTTTTTGTGAA
GTCACACTACCATCATANTACATAGTTTAGTACTATAGGGCTTTGCTGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI2225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 93961372..93961583 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042167 (Papd4) NM_133905 PAP associated domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2140950]


Sequence tag IST14757B6HMF1
Sequence
CAATAAAAATGGATCCATTAAAGATTCCAAAAGGGGGCTGGAGAGAGAGGACTCTGTGATTGAGAGCATTCATTGTTCTT
TCAGAGGCTGTGGGTTCAATTTCTAGTACCCATATGTGGTTCATAGCTGTATGTGGCTCCAATTCAAGGGATCTGATACC
CTTTTCTGACCTCCATGGCTGTGAGGCAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79956341..79956528 188
NO GENE  


Sequence tag IST14757B6BBF1
Sequence
AAAGTTCTCGTTTGAATATTTGCTACTACCACCAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 85867324..85867363 37
NO GENE  

 
Come back to gene ENSMUSG00000042167


For any suggestions or comments, please send an email to unitrap@crg.es