Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14378H5
Clone ID IST14378H5
Vector VICTR74
Project tigm

Sequence tag IST14378H5HMR1
Sequence
AGTACACTGTAGTTGTATAGATGGTTGTGAGCCTTCATGTGATTGTTGGGAATTGAATTTTAGGACCTCTGCTCGCTCTG
GTTGGCCCCACTAGCTCCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI17456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26719429..26719530 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072681 (Plac9) NM_207229 placenta specific 9 Gene [Source:MGI Symbol;Acc:MGI:2663998]

 
Come back to gene ENSMUSG00000072681


For any suggestions or comments, please send an email to unitrap@crg.es