Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12371B3
Clone ID IST12371B3
Vector VICTR76
Project tigm

Sequence tag IST12371B3BBF1
Sequence
TTCTCACACCCTTAAATCACCATGTAGCTTTCAACTCAGAGCAATTTCCTGCTTCAGCTTCCAGAGACCTGGGACTACAA
ATGAGCACTTGCTGAGTTTTTCCTTTTGCTTGTGGTATTGGGGCTAAGACACATGGCCTTTACATTCTAGGCAGGTGGTC
TCCCACTGAGCTACATCTCCAGCCCTGGAAGCCCTTTGTTAAGATATTTGATAGCTTTGGTGTGGAGGTGCACACCGTAA
TCCCCACACTTGGGAGGTAGAGACAAGCAGGAGGGTCAGGAGTTCAAGGTCATCCTCATGTACATGGCGAGTTTAAGGCA
AGAAAAAGTTAAATTCTTTTAATTAGTAAACGCCATCAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI16111

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65529997..65530360 364
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040652 (Oaz2) NP_035082 ornithine decarboxylase antizyme 2 Gene [Source:MGI Symbol;Acc:MGI:109492]

 
Come back to gene ENSMUSG00000040652


For any suggestions or comments, please send an email to unitrap@crg.es