Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10673F9
Clone ID IST10673F9
Vector VICTR76
Project tigm

Sequence tag IST10673F9HMF1
Sequence
CACACACACACACACACAATTANGAAAGCTNTTTTGAATTAAAAGAGTGCTTTTNATGGTCAACG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10673F9HMR1
Sequence
ATAATATAATTAAAGCAATTAAATACAGAAATGGGCTGGGGAATCTTTCCTACATTGTGGGACTTAAAAAAGCAAACAAA
CCAACCAACCCTTATTTTAAATTACTAAGTCCTGAAAAGATACACTGCCAAGAATTGTGACCTCCCANCCNANTACCANC
TGATCTGGGGGGCACAGTTCCGATTGTTTCCTTTGAATAGATCCTGTTTGATATTGCCCAGTTTTCAGTCCAATTTTACC
TTANTAATCAACCAAAATTATGGAAAGAAAACCAGGGTATCACACCTCATC
Sequence Type genomic DNA
Unitrap ID UNI17516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174288187..174288476 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016252 (Atp5e) NM_025983 ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit Gene [Source:MGI (curated);Acc:Atp5e-001]

 
Come back to gene ENSMUSG00000016252


For any suggestions or comments, please send an email to unitrap@crg.es