Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12727G6
Clone ID IST12727G6
Vector VICTR76
Project tigm

Sequence tag IST12727G6HMF1
Sequence
ATCTTGAGTTTCTCGTCTTTGAGATTGTCTCTGGAACATGTTAAAATTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI2049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4798720..4798773 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]


Sequence tag IST12727G6BBF1
Sequence
ATCTTGAGTTTCTCGTCTTTGAGATTGTCTCTGGAACATGTTAAAATTGTTAACTGCTCTTTGGATGTGANTTGNNTNCC
N
Sequence Type genomic DNA
Unitrap ID UNI2049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4798720..4798793 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es