Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0743
Clone ID CC0743
Vector pGT0lxfT2
Project sanger

Sequence tag CC0743
Sequence
TCCGCTTCCTGAGCTCCCCTCCGTGTATATCCTCCTTTCATTTTTTCCTTGGATTACCTTGTATATTATTTTCATTCTAT
CCAGCTCTATTTACTCCACCTCCACAGCTCCGTCCCTTTTATTCTCTCGCTGGGCTCGCTTCGCCTTTCTTAAGACTTTT
CTGTATCTCTTCGTCTCTCTCTCGCCTATCTTTCTTTGCTGGAAAACCTTGGGGAAGCTTCTTCACAACCAAGCCCTACA
CAGTATGCACAGGAGGCTGCACGGGTGAAGAGAGATACTCGGAGTGGGCCTGACTATCTTAAAGAACAAGAGCTGGCGGA
CCCAAAGCCGCCCGGGGACCAGACCGTCACTCTTCAGTTTGATTTCCACTTTGACTCTCTTTCCATCATCCTTTACAACA
GTGATAGCAGCCAG
Sequence Type mRNA
Unitrap ID UNI1505

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 67780288..67782357 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035284 (Vps13c) NM_177184 vacuolar protein sorting 13C (yeast) Gene [Source:MGI Symbol;Acc:MGI:2444207]

 
Come back to gene ENSMUSG00000035284


For any suggestions or comments, please send an email to unitrap@crg.es