Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14952B7
Clone ID IST14952B7
Vector VICTR76
Project tigm

Sequence tag IST14952B7HMF1
Sequence
ATGTGCACATCTTTTCATTTGTCTAGATCATTACTGTTAATTCCTATTTAAAGTGTTTTATAATTTCTTCTGTAGAAGTG
ATGTGCATATCTGTTTATTTTTGGCTATTTCAGTAATTTTAATGTATTCTGCGTTCTCTCTCTCTCTCTCTCTCTCTCTC
TCTCTCTCTCTCTNTNTT
Sequence Type genomic DNA
Unitrap ID UNI27108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62170217..62170389 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


Sequence tag IST14952B7BBF1
Sequence
ATGTGCACATCTTTTCATTTGTCTAGATCATTACTGTTAATTCCTATTTAAAGTGTTTTATAATTTCTTCTGTAGAAGTG
ATGTGCATATCTGTTTATTTTTGGCTATTTCAGTAATTTTAATGTATTCTGCGTTCTCTCTCTCTCTCTCTCTCTCTCNC
NCNCN
Sequence Type genomic DNA
Unitrap ID UNI27108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62170232..62170389 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


Sequence tag IST14952B7HMR1
Sequence
GGCCNAAGTCTTTTCNAAAGGTCAAGGTTCACAAGGTGAGATAATGCTATTTTTAGCATGAATTTAAATATTAATTTGCA
CATCTCTTCCGACACAGGCTGACAGTGGATTGGTACCCTGGAGATGAGTGGGGTTCAGAGTGTAGACCAAATACCTTTCC
TCTTATCCATGTTTGATGGGGTTCCAGTGCCTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI15558

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 65742626..65742837 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042439 (Zfp532) NM_207255 zinc finger protein 532 Gene [Source:MGI Symbol;Acc:MGI:3036282]

 
Come back to gene ENSMUSG00000042439


For any suggestions or comments, please send an email to unitrap@crg.es