Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12313A8
Clone ID IST12313A8
Vector VICTR76
Project tigm

Sequence tag IST12313A8BBF1
Sequence
GATCGATACTCCAAACTACTATTTCCTTTGATTTTTATGTTGGCCAATGTATTTTACTGGGCATACTACATGTATTTTTG
AGACGCCATTGAACTCTTGCATCACATAATGAGGTTAAGGGTATTCTAGAACATGTGTGTGCACTTCAGCTTAGAAAGCT
ACAAATGGGCTAATGTAACAATTATTCTAAGTTGTGTAGAAGCCCTAGTGTGACCAGATTCTATAATAGAGTCATTATAA
GGCAACCCTTTTCTTCTTCAATTTTGGACAGAACACCCCCTCCACACACATACACAGAACCCAAGACTGCGAACCTACTC
AGGGCTATTTGCTCTCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI13980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33452279..33452620 342
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020159 (Gabrp) NM_146017 gamma-aminobutyric acid (GABA-A) receptor, pi Gene [Source:MGI (curated);Acc:Gabrp-001]


Sequence tag IST12313A8HMF1
Sequence
GATCGATACTCCAAACTACTATTTCCTTTGATTTTTATGTTGGA
Sequence Type genomic DNA
Unitrap ID UNI13980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33452578..33452620 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020159 (Gabrp) NM_146017 gamma-aminobutyric acid (GABA-A) receptor, pi Gene [Source:MGI (curated);Acc:Gabrp-001]

 
Come back to gene ENSMUSG00000020159


For any suggestions or comments, please send an email to unitrap@crg.es