Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P109D11
Clone ID P109D11
Vector FlipROSAbetageo
Project ggtc

Sequence tag P109D11
Sequence
TCTCATTGAACGCGGAGGCAGCTGCCGGGCATTCGTGTGGTCTCGTCGTCAGCGCAGCTGGGCCTACACACAAG
Sequence Type mRNA
Unitrap ID UNI2623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5783561..5783634 70
 
EST/CDNA Est Name
  CB208837.2 - BE306869.1 - CJ077483.1 - CJ077526.1 - CJ071942.1 - AW260714.1 - CJ077482.1 - CJ082771.1 - CJ075038.1 - CX232971.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40609358..40609431 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015656 (Hspa8) NM_031165 heat shock protein 8 Gene [Source:MGI (curated);Acc:Hspa8-009]

 
Come back to gene ENSMUSG00000015656


For any suggestions or comments, please send an email to unitrap@crg.es