Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0725
Clone ID CC0725
Vector pGT0lxfT2
Project sanger

Sequence tag CC0725
Sequence
CTTTTCTACTTGCACATCTTCTTGCTCGCGCGGTCCTGCTGCCGTCCGGTGCTCCCCGTAGCCGCTCAGGCAGAGAGGTT
TTAAAATGGAACATTTCGATGCGTCACTCAGTACCTATTTCAAGGCCTTCCTGGGCCCCCGAGATACAAGAGTCAAAGGA
TGGTTCCTCCTGGACAATTACATCCTTACGTTTGTCTGTTCTGTTATTTACTTACTCATNGTATGGCTGGGACCAAAATA
CATGAAGAACCGGCAGCCGTTCTCTTGCCGAGGCATCCTGCAGTTGTATAACCTTGGACTCACCCTGCTGTCTCTCTACA
TGTTCTATGAG
Sequence Type mRNA
Unitrap ID UNI1506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77765265..77808860 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032349 (Elovl5) NM_134255 ELOVL family member 5, elongation of long chain fatty acids (yeast) Gene [Source:MGI (curated);Acc:Elovl5-001]

 
Come back to gene ENSMUSG00000032349


For any suggestions or comments, please send an email to unitrap@crg.es