Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14962E1
Clone ID IST14962E1
Vector VICTR76
Project tigm

Sequence tag IST14962E1BBF2
Sequence
TTATTATATGTGAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI4002 UNI16511 UNI31900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117571464..117571523 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025571 (Tnrc6c) NM_198022 trinucleotide repeat containing 6C Gene [Source:MGI (curated);Acc:Tnrc6c-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 112098555..112098614 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 31535814..31535873 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 33273994..33274053 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022808 (Snx4) NM_080557 sorting nexin 4 Gene [Source:MGI Symbol;Acc:MGI:1916400]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74865582..74865641 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89861886..89861945 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027942 (4933434E20Rik) NM_025762 RIKEN cDNA 4933434E20 gene Gene [Source:MGI Symbol;Acc:MGI:1914027]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 123334475..123334534 60
NO GENE  


Sequence tag IST14962E1HMF1
Sequence
TTATTATATGTGAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCATCAGATCTCATTATGGATGGTTGTGAGC
TACCATGTGGTTGTTGGGACTTGATCTTCGGAACTTCGGAAGAGCAGTCGGGTGCTCTTGCCCACTGAGCCNTCTCTCCA
NCCCAAGCCACGTCTTATTTTGTTATGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 123334475..123334663 185
NO GENE  

 
Come back to gene ENSMUSG00000027942


For any suggestions or comments, please send an email to unitrap@crg.es