Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14532F1
Clone ID IST14532F1
Vector VICTR74
Project tigm

Sequence tag IST14532F1BBF1
Sequence
ATCAAGGAACTTCACATAAAACCAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGAAATGGGCAC
AGGGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAATGGGACCTAATGAAACTCC
AAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGACAAAAAGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCT
AAATCAGATAGGGGACTAATATCCAACATATATAAAGAACTCATGAAGGTGGACCTCANAAAATCAAATAACCCCCTTAA
AAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGANGAATACCGAATGGCAGAGAAGCACCTGAAAAAATGTTCAA
CATCCTTAATCATCAGGGAAATGCAAATCAAAACAACCCTGANATTCCACCTCACACCAGTGANAATGGCTAAGANCAAA
AATTCNGGTGACAGCAGATGCTGGCNANGATGTGGANAAAGANGAACACTCCCTCCATTGTTGGTN
Sequence Type genomic DNA
Unitrap ID UNI4546

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71813893..71814436 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032228 (Tcf12) NM_011544 transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]


Sequence tag IST14532F1HMF2
Sequence
ATCAAGGAACTTCACATAAAACCAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGAAATGGGCAC
AGGGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAATGGGACCTAATGAAACTCC
AAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGACAAAAAGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCT
AAATCAGATAGGGGACTAATATCCAACATATATAAAGAACTCATGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTAA
AAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGANGAATACCGAATGGCAGANAAGCACCTGAAAAN
Sequence Type genomic DNA
Unitrap ID UNI4546

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71814046..71814436 387
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032228 (Tcf12) NM_011544 transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]


Sequence tag IST14532F1HMR1
Sequence
AAGAGGTCATTGGATCCCTAGAACTAGAGTTATGGGCAGTTGTGAGCCNCCACGTGGTGCN
Sequence Type genomic DNA
Unitrap ID UNI17336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115478368..115478427 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020744 (Slc25a19) NM_026071 solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19 Gene [Source:MGI (curated);Acc:Slc25a19-009]

 
Come back to gene ENSMUSG00000020744


For any suggestions or comments, please send an email to unitrap@crg.es