Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14424F6
Clone ID IST14424F6
Vector VICTR74
Project tigm

Sequence tag IST14424F6BBF1
Sequence
CTGTTCTCAGTCACAACAAAGGGAGCTAAAGAATGTGCAAAACATCATCCCTCCTCAAAGCAAACTCGGAGCGACCGCGT
TGTTCCCTTCTGCTTACTGTAACCTATGCACTGGGGAACACTGCAGTCACCTCTCCTTCCCAGTGGAGGGGGTGAGCTGC
CTCACAGCTTCAAACCCCAGCCTCTGGGGATTAGGACAGCTTGAAAAGGGGTGGGAGTGGCTCTCCCTGCCCACACCCTA
ANGNNNNNTTGAAACCACTATTTGCCCTTAACTCCGCAGCCCCTAAAAAGCACACCAAATTGTAAACATAAGGAAGTAGG
TTTCTGAGAAACAGACCCCACTGGAGGAAAAAGGCCGGCCCACTGCGCANCAGGCTCCGGACTGCCCAGTTTGAAAAGCC
TTCTNNTTCCTTCCTTANTCNCACTCTGCAGCTTCNAAAGCCNANAGATGCCTANGN
Sequence Type genomic DNA
Unitrap ID UNI29936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148153708..148154161 426
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025491 (Ifitm1) NM_026820 interferon induced transmembrane protein 1 Gene [Source:MGI (curated);Acc:Ifitm1-001]


Sequence tag IST14424F6HMF2
Sequence
GTGCCCACATCTGTTCTCCAGGGCAGATGCTCATAGAAAAGGGAGGTGGGGGAGGCCAGGGAAGCCTGGAGCACTAAAAG
CTTCCTTGGTGCCTAGGCTTCTCTGGGGCATCTTGGGAGTGGCCTTTGGGTGCTGCTGTGTCCAACAGGGACTTCCTTGG
GGAGGCCATGAACCACACGTGCTCACACAGCAAGCATAGCTCAGACCCTAGTTAAGCCTGAGAGCGCCAGGCTTTTGAGG
TTATTGTTNANNAAACTCTTGGGAGCCTAATCTTTAAACTCTCCCGCCCAAGGCCAGAGCCTGANCAATTANACACTGGG
GAGGAGAGAGGACAGGGAGGGGAGCGAGTANNNGNNNCGTGGAGGCGATGTCNNTNNNACNTNGTTNNCACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000025491


For any suggestions or comments, please send an email to unitrap@crg.es