Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10268H2
Clone ID IST10268H2
Vector VICTR76
Project tigm

Sequence tag IST10268H2HMR1
Sequence
GTTAATACATTNGGTTTGGCTTTTTAAACCTTTCTGATATATTATTGTCTGTGTGTCCTAGTTAGCTTAAGTTGTCC
Sequence Type genomic DNA
Unitrap ID UNI1559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121810873..121810948 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]

 
Come back to gene ENSMUSG00000078564


For any suggestions or comments, please send an email to unitrap@crg.es