Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10292G4
Clone ID IST10292G4
Vector VICTR76
Project tigm

Sequence tag IST10292G4BBF1
Sequence
ATCCCTTATGGTGTAATCCTGCAAGCCCTCAATTCGCTGTAACTTCTTCCTAATGTCAGGAGCTGACTGGCCAATGAAGG
CCATAATTACTGAGGCCCTTTGACCCTCAGACGTGGGGTCGAATGGGGTATATCTCCTATAAGCCTCCATGAGCCTTTCA
AGGAAGACTGAGGGGGGA
Sequence Type genomic DNA
Unitrap ID UNI31842 UNI31905

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24696835..24697011 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 19933290..19933466 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 67744568..67744744 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45060647..45060823 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 25669012..25669188 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 114500236..114500412 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 17042252..17042428 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124358786..124358962 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 58773436..58773612 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 82060850..82061026 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037605 (Lphn3) NM_198702 latrophilin 3 Gene [Source:MGI (curated);Acc:Lphn3-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34294607..34294783 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 55388103..55388279 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20308943..20309119 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 83983880..83984056 177
NO GENE  


Sequence tag IST10292G4HMF1
Sequence
ATCCCTTATGGTGTAATCCTGCAAGCCCTCAATTCGCTGTAACTTCTTCCTAATGTCAGGAGCTGACTGGA
Sequence Type genomic DNA
Unitrap ID UNI16365 UNI31842 UNI35765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24696835..24696904 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 55957090..55957159 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 19933290..19933359 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 67744675..67744744 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 41998184..41998253 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056899 (Immp2l) NP_444352 IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2135611]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 9348794..9348863 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004668 (Abca13) NM_178259 ATP-binding cassette, sub-family A (ABC1), member 13 Gene [Source:MGI (curated);Acc:Abca13-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 25669012..25669081 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 114500236..114500305 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 17042252..17042321 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124358893..124358962 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 58773436..58773505 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13756008..13756077 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24280230..24280299 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34294607..34294676 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 55388103..55388172 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20308943..20309012 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 83983880..83983949 70
NO GENE  

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es