Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10241F11
Clone ID IST10241F11
Vector VICTR76
Project tigm

Sequence tag IST10241F11HMF1
Sequence
TTCCTCAGTTGCCAGGGCAACCGTTTTCCATCTACCAGTGTTTTCTGTCTCCATGCTCCCAAAGACATAACACCCACGAG
TGTGGGCTCGGGTGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI30749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 151807343..151807440 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031075 (Tmem16a) NM_178642 anoctamin 1, calcium activated chloride channel Gene [Source:MGI (curated);Acc:Tmem16a-001]

 
Come back to gene ENSMUSG00000031075


For any suggestions or comments, please send an email to unitrap@crg.es