Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10005D2
Clone ID IST10005D2
Vector VICTR76
Project tigm

Sequence tag IST10005D2BBF2
Sequence
TTTGAAGGAACTGGGAAGGCACTGGGGACTCGGAGCCCTGCTTTGTGCCTCCCTCTTCCCTGGAGATAGAAGTCCCTGAT
AACAAGGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI31333

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104166814..104166904 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST10005D2HMF3
Sequence
GTTGAAGGACCAGGGAAGGCACTGGGGACTCGGAGCCCTGCTTTGTGCCTCCCTCTTCCCTGGAGATAGAAGTCCCTGAT
AACCAGGGGATCCGAGTTTGTAAATTAGGGCTCTGAGCTGAGCATGGTAACTGATGCCTATAACCAATCCCGGCACTGAG
CATGATTTCCGTAAGTCAGAAGCTAGCTTGAGCTATACAGTGAGCTCCAGGCTAGCCTGGGCTACAGTGTGAGTGAGGTT
CTAGCTTGAGAAATAAAGAAAGAAACCAGGTGTGGTAGTGCTCATAATCCCAGCACCCTGGAGTAAGAGGCAGGAGGCTC
ACCGCAATTGCCTAGATGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI31333

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104166813..104167155 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es