Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14232F10
Clone ID IST14232F10
Vector VICTR74
Project tigm

Sequence tag IST14232F10HMR1
Sequence
NNNTNACTGTCTCTCGCCCTGCAGTTCACTCTAACTCTGCTGTCCTACATACAGTCNCTCCTGATTGTAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106670591..106670658 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]


Sequence tag IST14232F10HMF1
Sequence
CCCTTAGGTTCTCAGACTCCCAGGCCTCTTTTTTAACTATTGGGAAGTCTGAGCCTTGTGGTCTCCTGGGGGCGGAGTCA
GGAAAGAAATGGCTGTTAGGGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155756058..155756161 104
NO GENE  


Sequence tag IST14232F10BBF2
Sequence
GAGTAAAGGCACCACTGGCNACCATGCCTGAAGACCTGANNNNGATCCCTCAAAACCCAAACAGTAGAAGAAAAGAACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es