Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14959H7
Clone ID IST14959H7
Vector VICTR76
Project tigm

Sequence tag IST14959H7HMR1
Sequence
GTGNACCTTCNNACNTNANTTTCNTCCACCTCAATTAACTTAAAGACNATACCACACAGGCATGTCCCCAGACCAACCTA
AGCTAGACCTNACTCTGCACTCTTTCCTGGTGATTCTGGACGTTATCACATCCACAGAAAAGCTAACCCTCCCACCTGCC
TAGGGACATTAACATTTACTCTGTATGATAGAGCCGTGTGGGTTACTGCAGGAAGCGAATAAATTATGTTGATTTTATCA
ATGGCTTACAGAGAGTCCAGCTCCTCCAGTGCTGAGTANAAGTGGCTCCTGTGTAGAGGTCCCAGGGCTGCTTANCTGCA
ACGCCAGGCATCTGCTGGACAACAGCACAAGGCACACTGGATCTGCTCATCTAATGGAANGAAAGGAAGTGTGCATTCAT
ANATATTATTCACTATTTTANATTCCTTATTGTCACTTTCAANAATAANAATATGTTCCTGTGTTTGGGGAGGNAAATTT
ATNCTNNNGN
Sequence Type genomic DNA
Unitrap ID UNI9316

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30916560..30917044 449
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037643 (Prkci) NP_032883 protein kinase C, iota Gene [Source:MGI Symbol;Acc:MGI:99260]


Sequence tag IST14959H7BBF1
Sequence
TTGTCAGGTTTCCCTGGCACTGGAGTTACAGCACTTTGTGAGCTACCATATACGCTCTGGGATCAAACACAGGACCCCTG
CAAGAGCAAGTGTCCTCAACCTGCTGAGTCACCTCCCGACCCCTAAAATGATAATTAAAAAAAAATACATTTATCTATTT
ATTTTGGTGTTCNGANACAGGTTCTGCTCTCTCTGGAGCCCAGGCTANCCTTGAATTGCCTCANCCTCCTGAGTTGCTAG
GACCGCNCCTGCCTGTTTGANCNCATTGNCCAGGTTGAAAGTGCNNNTNANGN
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79459434..79459716 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]


Sequence tag IST14959H7HMF2
Sequence
CCTTAACCTGACCCCTCTGCAATGGAGTGGAGCTAACATAAGCCCCTTCTCCCCTAGGCTGCTTTTATTGGAGGATTTGA
TCTCAGCGACTGGGAAGAAGATTTGAACATCGGGGTCTACAGGCCCCTCAGGAGCTGTCCCTGGCTACCTGCCAGGCCTA
CTTCTCCAATGGCACACAAACGTGTGCTTGTATTACCCCCTGTCCCAAATGGAACACAATGAAACTTGGTGAAGTGAAGG
CAGAGATGTGGTTTTTTGTTNNGATGTTNTTGNNNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30916288..30916559 264
NO GENE  

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es