Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14790F7
Clone ID IST14790F7
Vector VICTR76
Project tigm

Sequence tag IST14790F7HMR1
Sequence
NGANNACCCCNTCNTGCANAAAACNCAGNAAGAAAGAACAAAGGAAGTTCTTTTCACTTTTCCTGCGTTTATTGTTTTAA
GAGAGAATCAAAGGGCGGCCTGGGGTACATAATATTCTGCCTCAAAAATACACATAAAATAAAACCAGGGGCTGGAGAGG
TGGCTTCGCAATTAAGAGCGCTGGCTGCTCTTATGAGGACCTGTTTGCCTCTTGGCAGCCGCACCAGGAGCCTCCCCAGG
CACACTCTTGATTAAAAATAAATCTTANAAAACACCGACAGACACAGTTGTCCAACAGCACGGTGTGTGCAGTCTTGCTG
ANCTCGGCTTGCCCATTTTTTCAATTATAGCTTTCATCTCAATCCANTCATTATATATGTTTTTCATTTTTCTTCTGTTT
TGTTTTTTTGTTTTCTGAAACAGGGACTTTCCTGTGTACTGTAAGCCNCCCACAGCCTGANTCCCCTCNNCANCACTGGG
GTCACANATGCCCANTGCCATGCNTGGN
Sequence Type genomic DNA
Unitrap ID UNI12540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21592572..21593073 470
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]


Sequence tag IST14790F7BBF1
Sequence
TTCCTATGTAGCCCTCACTGTCCTGGAACTCGCTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCTGCCTGCCTCTGC
CTCCAGTGCTGGGATTAAAAGGTGTGTGCCACCACTACAAAGCTTTTCCTTTTTTATTTTCTGCGTCCTCTAACCGTTGA
TCCTCTGCCTCCATCTCCACACACCCTCTCCAGCCAAGACGGCCCAAGCCAGTGTTTATCTACATCCTCTTTCTTTTCCA
TTCCGTTCTCTGTTCTCTCTAAAGCAAGATGGCATCTTGCTATGTAGCCCTANAAGTACCTAGGACTCACCACAATCCTC
CTGCCTCANTCTCCCAAGTGCAGAAATGAGCTTGGTAGGCTATATGTGCTATGATGCTCGGTAGCNTTTGCATTNNNATG
TGGCTGGNGAAAAACAAANNGAAAACATGANANGTCCANGTTCANGGNNNCNGCCCAGGAACAGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21593075..21593538 429
 
EST/CDNA Est Name
  CN458213.1 - BX516222.1 - AA823251.1


Sequence tag IST14790F7HMF1
Sequence
TTCCTATGTAGCCCTCACTGTCCTGGAACTCGCTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCTGCCTGCCTCTGC
CTCCAGTGCTGGGATTAAAAGGTGTGTGCCACCACTACAAAGCTTTTCCTTTTTTATTTTCTGCGTCCTCTAACCGTTGA
TCCTCTGCCTCCATCTCCACACACCCTCTCCAGCCAAGACGGCCCAAGCCAGTGTTTATCTACATCCTCTTTCTTTTCCA
TTCCGTTCTCTGTTCTCTCTAAAGCAAGATGGCATCTTGCTATGTANCCCTANAAGTACCTANGACTCACCACAATCCTC
CTGCCTNANTCTCCCAAGTGCANANATGANCTTGGTANGCTATANGTGCTATGATGCTNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21593075..21593452 358
 
EST/CDNA Est Name
  BX516222.1 - AA823251.1

 
Come back to gene BX516222.1 - AA823251.1


For any suggestions or comments, please send an email to unitrap@crg.es